Mature sequence sma-miR-125b

Accession numberMIMAT0010184
IDsma-miR-125b
Stem-Loop sma-mir-125b
Sequence
ucccugagacugauaauugcuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19107204 "Identification and characterization of novel microRNAs from Schistosoma japonicum" Xue X, Sun J, Zhang Q, Wang Z, Huang Y, Pan W PLoS One. 3:e4034(2008).