Mature sequence mdm-miR482a-3p

Accession numberMIMAT0011165
IDmdm-miR482a-3p
Previous IDsmdm-miR482
Stem-Loop mdm-MIR482a
Sequence
uucccaagcccgcccauuccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19353277 "Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress" Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL Plant Mol Biol. 70:385-401(2009).
2
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).