Mature sequence sme-let-7d

Accession numberMIMAT0011225
IDsme-let-7d
Stem-Loop sme-let-7d
Sequence
agagguagugauucaaaaaguu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).