Mature sequence cel-miR-2209a-3p

Accession numberMIMAT0011432
IDcel-miR-2209a-3p
Previous IDscel-miR-2209a
Stem-Loop cel-mir-2209a
Sequence
agagaucagcgguuacacuaca
Get sequence
Deep sequencing7083 reads, 16 experiments
Database links
Predicted targets
QuickGO function

References

1