Mature sequence osa-miR2118c

Accession numberMIMAT0011742
IDosa-miR2118c
Stem-Loop osa-MIR2118c
Sequence
uucccgaugccuccuauuccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).