Mature sequence osa-miR2118e

Accession numberMIMAT0011744
IDosa-miR2118e
Stem-Loop osa-MIR2118e
Sequence
uucccaaugccucccaugccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).