Mature sequence osa-miR2118h

Accession numberMIMAT0011747
IDosa-miR2118h
Stem-Loop osa-MIR2118h
Sequence
uuccugaugccucucauuccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).