Mature sequence osa-miR2118i

Accession numberMIMAT0011748
IDosa-miR2118i
Stem-Loop osa-MIR2118i
Sequence
uuccuagugccucccauuccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).