Mature sequence osa-miR2118j

Accession numberMIMAT0011749
IDosa-miR2118j
Stem-Loop osa-MIR2118j
Sequence
uuccugaugccucccauuccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).