Mature sequence zma-miR2118a

Accession numberMIMAT0011760
IDzma-miR2118a
Stem-Loop zma-MIR2118a
Sequence
uuccugaugccucucauuccua
Get sequence
Deep sequencing8 reads, 4 experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).