Mature sequence dps-miR-2517-3p

Accession numberMIMAT0012343
IDdps-miR-2517-3p
Previous IDsdps-miR-2517a
Stem-Loop dps-mir-2517-1 dps-mir-2517-2 dps-mir-2517-3
Sequence
uauugauuugguggauuugaaaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).