Mature sequence dsi-miR-999-3p

Accession numberMIMAT0012456
IDdsi-miR-999-3p
Previous IDsdsi-miR-999
Stem-Loop dsi-mir-999
Sequence
uguuaacuguaagacugugucu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).