Mature sequence rno-miR-592

Accession numberMIMAT0012834
IDrno-miR-592
Stem-Loop rno-mir-592
Sequence
auugugucaauaugcgaugaugu
Get sequence
Deep sequencing10925 reads, 263 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23971736 "Novel cerebellum-enriched miR-592 may play a role in neural progenitor cell differentiation and neuronal maturation through regulating Lrrc4c and Nfasc in rat" Zhang J, Zhang J, Zhou Y, Wu YJ, Ma L, Wang RJ, Huang SQ, Gao RR, Liu LH, Shao ZH, Shi HJ, Cheng LM, Yu L Curr Mol Med. 13:1432-1445(2013).