Mature sequence rno-miR-668

Accession numberMIMAT0012839
IDrno-miR-668
Stem-Loop rno-mir-668
Sequence
ugucacucggcucggcccacuacc
Get sequence
Deep sequencing22249 reads, 302 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).