Mature sequence eca-miR-196b

Accession numberMIMAT0012939
IDeca-miR-196b
Stem-Loop eca-mir-196b
Sequence
uagguaguuuccuguuguuggg
Get sequence
Deep sequencing19 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).