Mature sequence eca-miR-127

Accession numberMIMAT0013126
IDeca-miR-127
Stem-Loop eca-mir-127
Sequence
ucggauccgucugagcuuggcu
Get sequence
Deep sequencing162487 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).