Mature sequence eca-miR-432

Accession numberMIMAT0013157
IDeca-miR-432
Stem-Loop eca-mir-432
Sequence
ucuuggaguaggucauugggugg
Get sequence
Deep sequencing2166 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).