Mature sequence eca-miR-223

Accession numberMIMAT0013205
IDeca-miR-223
Stem-Loop eca-mir-223
Sequence
ugucaguuugucaaauacccca
Get sequence
Deep sequencing102 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).