Mature sequence eca-miR-450a

• Accession number: MIMAT0013219
• ID: eca-miR-450a
• Stem-Loop: eca-mir-450a
• Sequence: uuuugcgauguguuccuaauau
• Deep sequencing: 2140 reads, 1 experiments

References

1. PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).