Mature sequence eca-miR-450a

Accession numberMIMAT0013219
IDeca-miR-450a
Stem-Loop eca-mir-450a
Sequence
uuuugcgauguguuccuaauau
Get sequence
Deep sequencing2140 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).