Mature sequence eca-miR-509a-5p

Accession numberMIMAT0013233
IDeca-miR-509a-5p
Previous IDseca-miR-509-5p
Stem-Loop eca-mir-509a
Sequence
uacugcagacaguggcaauca
Get sequence
Deep sequencing2148 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).