Mature sequence eca-miR-660

Accession numberMIMAT0013241
IDeca-miR-660
Stem-Loop eca-mir-660
Sequence
uacccauugcauaucggaguug
Get sequence
Deep sequencing2450 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).