Mature sequence bmo-miR-2799

Accession numberMIMAT0013703
IDbmo-miR-2799
Stem-Loop bmo-mir-2799
Sequence
agagguuuaugaacaugaugag
Get sequence
Deep sequencing65 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).