Mature sequence zma-miR159f-3p

Accession numberMIMAT0013975
IDzma-miR159f-3p
Previous IDszma-miR159f
Stem-Loop zma-MIR159f
Sequence
uuuggauugaagggagcucug
Get sequence
Deep sequencing10032 reads, 195 experiments
Database links
QuickGO function

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).