Mature sequence zma-miR171n-3p

Accession numberMIMAT0013997
IDzma-miR171n-3p
Previous IDszma-miR171n
Stem-Loop zma-MIR171n
Sequence
ugauugagccgcgccaauauc
Get sequence
Deep sequencing2198 reads, 130 experiments

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).