Mature sequence osa-miR395x

Accession numberMIMAT0014124
IDosa-miR395x
Stem-Loop osa-MIR395x
Sequence
gugaaguguuuggaguagcuc
Get sequence
Deep sequencing6 reads, 2 experiments

References

1