Mature sequence rco-miR169c

Accession numberMIMAT0014171
IDrco-miR169c
Stem-Loop rco-MIR169c
Sequence
ugagccaaggaugacuugccg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).