Mature sequence aae-miR-92b-5p

Accession numberMIMAT0014321
IDaae-miR-92b-5p
Previous IDsaae-miR-92b*
Stem-Loop aae-mir-92b
Sequence
aggucgugacuugugcccguuug
Get sequence
Deep sequencing326 reads, 2 experiments

References

1