Mature sequence api-miR-3038

Accession numberMIMAT0014775
IDapi-miR-3038
Stem-Loop api-mir-3038
Sequence
ugggguuucaauaggcauuuacc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).