Mature sequence hsa-miR-548x-3p

• Accession number: MIMAT0015081
• ID: hsa-miR-548x-3p
• Previous IDs: hsa-miR-548x
• Stem-Loop: hsa-mir-548x hsa-mir-548x-2
• Sequence: uaaaaacugcaauuacuuuc
• Deep sequencing: 4293 reads, 87 experiments
• Database links:
  • RNAcentral:URS000043D2C1_9606
• Predicted targets:
  • TargetMiner:hsa-miR-548x-3p
  • TargetScanVert:hsa-miR-548x-3p
  • miRDB:hsa-miR-548x-3p
  • microrna.org:hsa-miR-548x-3p

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).