Mature sequence bmo-bantam-5p

Accession numberMIMAT0015278
IDbmo-bantam-5p
Previous IDsbmo-bantam*
Stem-Loop bmo-bantam
Sequence
cugguuuucauaaugauuugaca
Get sequence
Deep sequencing12 reads, 2 experiments

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).