Mature sequence zma-miR166n-5p

Accession numberMIMAT0015321
IDzma-miR166n-5p
Previous IDszma-miR166n*
Stem-Loop zma-MIR166n
Sequence
ggauuguugucuggcucggug
Get sequence
Deep sequencing355 reads, 119 experiments
Database links
QuickGO function

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).