Mature sequence ssc-miR-338

Accession numberMIMAT0015713
IDssc-miR-338
Stem-Loop ssc-mir-338
Sequence
uccagcaucagugauuuuguug
Get sequence
Deep sequencing14 reads, 4 experiments

References

1
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).