Mature sequence cin-miR-4072-3p

Accession numberMIMAT0016633
IDcin-miR-4072-3p
Stem-Loop cin-mir-4072
Sequence
aaaauggaucuugacaaaac
Get sequence
Deep sequencing reads, experiments

References

1