Mature sequence cin-miR-4085-5p

Accession numberMIMAT0016659
IDcin-miR-4085-5p
Stem-Loop cin-mir-4085
Sequence
ucgcacguugugcaggcaagc
Get sequence
Deep sequencing reads, experiments

References

1