Mature sequence bta-miR-3601

Accession numberMIMAT0016936
IDbta-miR-3601
Stem-Loop bta-mir-3601
Sequence
ucucgugacaugaugauccccga
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).