Mature sequence rno-miR-143-5p

Accession numberMIMAT0017129
IDrno-miR-143-5p
Previous IDsrno-miR-143*
Stem-Loop rno-mir-143
Sequence
ggugcagugcugcaucucugg
Get sequence
Deep sequencing36862 reads, 463 experiments
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).