Mature sequence mmu-miR-541-3p

Accession numberMIMAT0017209
IDmmu-miR-541-3p
Previous IDsmmu-miR-541*
Stem-Loop mmu-mir-541
Sequence
uggcgaacacagaauccauacu
Get sequence
Deep sequencing2496 reads, 60 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).