Mature sequence mmu-miR-669l-3p

Accession numberMIMAT0017345
IDmmu-miR-669l-3p
Previous IDsmmu-miR-669l*
Stem-Loop mmu-mir-669l
Sequence
auauacauacacacccauauau
Get sequence
Deep sequencing1380 reads, 76 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).
2
PMID:18923076 "Mouse ES cells express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer-dependent small RNAs" Babiarz JE, Ruby JG, Wang Y, Bartel DP, Blelloch R Genes Dev. 22:2773-2785(2008).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).