Mature sequence aly-miR159c-3p

Accession numberMIMAT0017428
IDaly-miR159c-3p
Previous IDsaly-miR159c
Stem-Loop aly-MIR159c
Sequence
uuuggauugaagggagcuccu
Get sequence
Deep sequencing7092 reads, 1 experiments

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).