Mature sequence aly-miR164a-5p

Accession numberMIMAT0017449
IDaly-miR164a-5p
Previous IDsaly-miR164a
Stem-Loop aly-MIR164a
Sequence
uggagaagcagggcacgugca
Get sequence
Deep sequencing170 reads, 1 experiments
Database links
QuickGO function

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).