Mature sequence aly-miR169i-5p

Accession numberMIMAT0017501
IDaly-miR169i-5p
Previous IDsaly-miR169i
Stem-Loop aly-MIR169i
Sequence
uagccaaggaugacuugccug
Get sequence
Deep sequencing32 reads, 1 experiments

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).