Mature sequence aly-miR169m-5p

Accession numberMIMAT0017509
IDaly-miR169m-5p
Previous IDsaly-miR169m
Stem-Loop aly-MIR169m
Sequence
uagccaaggaugacuugccug
Get sequence
Deep sequencing31 reads, 1 experiments

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).