Mature sequence aly-miR169n-5p

Accession numberMIMAT0017511
IDaly-miR169n-5p
Previous IDsaly-miR169n
Stem-Loop aly-MIR169n
Sequence
uagccaaagaugacuugccug
Get sequence
Deep sequencing23 reads, 1 experiments

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).