Mature sequence aly-miR172e-3p

Accession numberMIMAT0017530
IDaly-miR172e-3p
Previous IDsaly-miR172e
Stem-Loop aly-MIR172e
Sequence
gaaucuugaugaugcugcau
Get sequence
Deep sequencing3087 reads, 1 experiments
Database links
QuickGO function

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).