Mature sequence aly-miR394b-5p

Accession numberMIMAT0017545
IDaly-miR394b-5p
Previous IDsaly-miR394b
Stem-Loop aly-MIR394b
Sequence
uuggcauucuguccaccucc
Get sequence
Deep sequencing22 reads, 1 experiments
Database links
QuickGO function

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).