Mature sequence aly-miR397a-3p

Accession numberMIMAT0017562
IDaly-miR397a-3p
Previous IDsaly-miR397a*
Stem-Loop aly-MIR397a
Sequence
ccggcguugcgcucaauuaug
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).