Mature sequence aly-miR822-5p

Accession numberMIMAT0017599
IDaly-miR822-5p
Previous IDsaly-miR822
Stem-Loop aly-MIR822
Sequence
auguaacgcauguuguuuucu
Get sequence
Deep sequencing13 reads, 1 experiments
Database links
QuickGO function

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).