Mature sequence aly-miR319d-3p

Accession numberMIMAT0017664
IDaly-miR319d-3p
Previous IDsaly-miR319d
Stem-Loop aly-MIR319d
Sequence
uuggacugaagggagcuccuu
Get sequence
Deep sequencing2133 reads, 1 experiments

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).