Mature sequence aly-miR848-3p

Accession numberMIMAT0017690
IDaly-miR848-3p
Previous IDsaly-miR848
Stem-Loop aly-MIR848
Sequence
ugacaugggacuaacagacuaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).