Mature sequence aly-miR3436-5p

• Accession number: MIMAT0017703
• ID: aly-miR3436-5p
• Previous IDs: aly-miR3436
• Stem-Loop: aly-MIR3436
• Sequence: cgagcaaaaaucauuguugau
• Deep sequencing: 4 reads, 1 experiments

References

1. PMID:20407023 "Arabidopsis lyrata small RNAs: transient MIRNA and small interfering RNA loci within the Arabidopsis genus" Ma Z, Coruh C, Axtell MJ Plant Cell. 22:1090-1103(2010).
2. PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).