Mature sequence aly-miR3436-5p

Accession numberMIMAT0017703
IDaly-miR3436-5p
Previous IDsaly-miR3436
Stem-Loop aly-MIR3436
Sequence
cgagcaaaaaucauuguugau
Get sequence
Deep sequencing4 reads, 1 experiments

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).